Python-Course

Crash Course in Python with an Introduction to Linux for absolute beginners

View on GitHub

Day-1 Day-2 Day-3 Day-4 Day-5 Day-6 Day-7 Day-8

Regular Expression (Regex) - Part II

Last week, we had an introduction to regular expression. We imported re module, we searched for patterns using re.search() function. We also understood about alternators, character grouping and quantifiers which are used for pattern searching. Here is a table summarizing all the concepts discussed so far.

S.No Identifier Purpose
1. | Alternator
2. ? Preceding character Zero or One times
3. + Preceding character One or More times
4. * Preceding character Zero or More times
5. […] Group of characters out of which, one is matched
6. {…} Matching a specific number of times, preceding character occurs
7. {..,..} Matching a range of values in which preceding character occurs

Moving on, this week we will learn two more identifiers.

S.No Identifier Purpose Example
8. ^ Matches the pattern at starting positions only ^TTT matches TTTAAA but not AAATTTAAA
9. $ Matches the pattern at the end positions only TTT$ matches AAATTT but not TTTAAAATTTAAA

Similar to re.search(), we have re.match() which will match a pattern as a complete string, whereas re.search() will match the pattern anywhere in the string.

Extracting part of the string that matched:

Now, let us focus on re.search(). re.search() function matches a particular pattern and returns an match object. Using this object, different functions can be used to identify features such as

  1. The location of the pattern in the string.
  2. The number of times each pattern that occurs in the string.
  3. Start and stop position of the pattern in the string and so on…

One such method is called the group() method. If we use this group() function on the match object, we can identify the pattern that matched. For example, here is a code from last week

import re
dna = "ACTGATCGTAGCTCGTGAATTCACACGAA"
if re.search(r"GC[ATGC]GC", dna):
  print("Restriction Enzyme Site found!!!")

The code snippet above matches one of the following, GCAGC or GCTGC or GCGGC or GCCGC. To find out the exact pattern,

import re
dna = "ACTGATCGTAGCTCGTGAATTCACACGAA"
m = re.search(r"GA([ATGC]{3})AC", dna)
print("Entire Pattern" + m.group())

If the pattern has more than one unknown parts, we can extract them by using group(1), group(2)and so on. For example,

import re
dna = "ACTGATCGTAGCTCGTGAATTCACACGAA"
m = re.search(r"GA([ATGC]{3})([ATGC]{2})AC", dna)
print("Entire Pattern :" + m.group())
print("First Bit of pattern :" + m.group(1))
print("Second Bit of pattern :" + m.group(2))

Here, notice the use of parentheses. Identifying the unknown bits in pattern by use of parenthesis is called capturing.

Finding the position of the match

The match object can be used to identify the position of the pattern in a long string. Position is identified using start() and stop() function.

import re
dna = "ACTGATCGTAGCTCGTGAATTCACACGAA"
m = re.search(r"GA([ATGC]{3})([ATGC]{2})AC", dna)
print("Entire Pattern :" + m.group())
print("Pattern start position:" + str(m.start()))
print("Pattern end position:" + str(m.end()))

Identical to capturing in group() function, start() and end() functions also support the use of parenthesis.

import re
dna = "ACTGATCGTAGCTCGTGAATTCACACGAA"
m = re.search(r"GA([ATGC]{3})([ATGC]{2})AC", dna)
print("Entire Pattern :" + m.group())
print("Pattern start position:" + str(m.start()))
print("Pattern end position:" + str(m.end()))
print("First Bit start position:" + str(m.start(1)))
print("First Bit end position:" + str(m.end(1)))
print("Second Bit start position:" + str(m.start(2)))
print("Second Bit end position:" + str(m.end(2)))

Splitting a string using regular expression

A string can be split using a pattern. This is made possible with the use of re.split() function.

import re
dna = "ACTNGCATRGCTACGTYACGATSCGAWTCG"
split_strings = re.split(r"[^ATGC]", dna)
print(split_strings)

Finding Multiple matches

So far, all the functions that we learnt finds only the first occurrence of the pattern. However, if we have to find all the occurrence of the pattern, we can use re.findall() function.

import re
dna = "ATATATGCGCGCGATGCATGCATCGTAGCTAGCTATATATTATATATTAGCTGCGCGCGCTAGCTAGATTACCTAGCTAGCATCGTATATATATATCGCTAGCTACTACT"
pattern = re.findall(r"[AT]{6,100}",dna)
print(pattern)

Since re.findall() function returns a list of string object, the exact start and stop position of the pattern can not be identified. To do something more complicated than just identifying the pattern, we can use re.finditer() function. This function returns a list of match object instead of string object. Hence, start(), stop() and other function can be applied.

import re
dna = "ATATATGCGCGCGATGCATGCATCGTAGCTAGCTATATATTATATATTAGCTGCGCGCGCTAGCTAGATTACCTAGCTAGCATCGTATATATATATCGCTAGCTACTACT"
pattern = re.finditer(r"[AT]{6,100}",dna)
for match in pattern:
  match_start = match.start()
  match_end = match.end()
  print("AT rich region starts from" + str(match_start) +"to"+ str(match_end))

Practice Space:

Challenge:

Accession names

Here’s a list of made-up gene accession names: xkn59438, yhdck2, eihd39d9, chdsye847, hedle3455, xjhd53e, 45da, de37dp.
Write a program that will print only the accession names that satisfy the following criteria – treat each criterion separately:
• contain the number 5
• contain the letter d or e
• contain the letters d and e in that order
• contain the letters d and e in that order with a single letter between them
• contain both the letters d and e in any order • start with x or y
• start with x or y and end with e
• contain three or more numbers in a row
• end with d followed by either a, r or p

Double digest

Use dna.txt which contains a made-up DNA sequence. Predict the fragment lengths that we will get if we digest the sequence with two made-up restriction enzymes – AbcI, whose recognition site is ANT*AAT, and AbcII, whose recognition site is GCRW*TG (asterisks indicate the position of the cut site).