Day-1 Day-2 Day-3 Day-4 Day-5 Day-6 Day-7 Day-8

Basic Linux Commands

Last week we learnt ls, pwd and cd. Lets learn few more commands which will help in understanding more about linux.

$mkdir
$rmdir
$touch
$rm
$cp
$mv

Linux directory structure

Linux Boot process

Absolute paths vs Relative paths

What is a path?
A path is a unique location to a file or a folder in a file system of an OS. A path to a file is a combination of / and alpha-numeric characters.

What is an absolute path?
An absolute path is defined as the specifying the location of a file or directory from the root directory(/). In other words we can say absolute path is a complete path from start of actual filesystem from / directory. For example

$cd /home/dinosaur/Desktop/my_file.txt

What is the relative path?
Relative path is defined as path related to the present working directory(pwd). Suppose I am located in /home/dinosaur and I want to change directory to /home/dinosaur/Downloads. I can use relative path concept to change directory to kernel.

$pwd
/home/dinosaur
$cd ./Downloads/songs/rock/
$pwd 
/home/dinosaur/Downloads/songs/rock

Shortcuts to remember:

Comes in handy with cd and cp commands.

S.No.	Symbol	Description
1.	.	This directory/ Present directory (Period)
2.	..	One directory up the hierarchy (Double Dot)
3.	-	Previous location (Hyphen)
4.	~	Home (Tilde)

For example:

$pwd 
/home/dinosaur/Downloads/songs/rock
$cd ../../../
$pwd
/home/dinosaur

Python

Online python interpreter

Data types

They are differrent data types in python.Last week we discussed three data types which are str(), int() and float(). This week we will learn about lists and dictionary which are frequently used.

List

List is a datatype available in Python which can be written as a list of comma-separated values between square brackets. A major feature of a list is that items in a list need not be of the same datatype.

A list is declared as follows:

list =[]

Here is an example of list:

list = ["Biology", "Physics", "Chemistry", 4, 5, 6]
print list
"Biology", "Physics", "Chemistry", 4, 5, 6

Last week we used a function called input() using which user enters a particular information.

name = input("What's your name?\n")
Dinosaur
print(name)
Dinosaur

Now, remember, all the strings and lists are indexed in python and the indexing starts from 0. It means

name[0]
"D"
name[1]
"i"
list[0]
"Biology"
list[3]
4

Dictionary

Dictionary is a useful datatype where the values are stored as key:value pairs. An example will help in understanding this data type better.

A dictionary is declared as follows:

dictionary = {}

Example:

GC_content = {45:"ATGATGCTAGCTAGCTAGCATGCAT", 0 :"ATATATATATTATTTTATATATATATATA", 49 : "CTAGTGCATGCTAGCTAGCTAGCTAGCTAGTCGTAGCTAGTCGATCGTACT", 64 : "GCAGCAGCAGCGCGTGCTAGCAGCAGCGCAGCTGCTAGTCGATCGTA", 50:"GCAGCAGCAGCGCGTGCTAGCAGCAGCGCAGCTGCTAGTCGATCGTA", 100: "GCGCGCGCGCGCGCGCCCCGGGGCGCGCGCGCGCGGGG"}
print(GC_content[45])
"ATGATGCTAGCTAGCTAGCATGCAT"

What’s the difference between lists and dictionaries?

A list is an ordered sequence of objects, whereas dictionaries are unordered sets. But the main difference is that items in dictionaries are accessed via keys and not via their position/index.

Challenge:

For the given a nucleotide sequence and four integers a, b, c and d. Extract regions from a through b and c through d.

nucleotide = "ATGCTATATCGGCTACTACGTAGCTAGTCGATGCTAGTCGA"
a = 3
b = 9
c = 6
d = 15

Optional: Make it better by obtaining the sequence and numbers from the user.

Expected Result

Desired Sequence from 3 to 9 is GCTATAT
Desired Sequence from 6 to 15 is ATATCGGCTA

HINT: Think in terms of list and index/position